mirror of
https://github.com/gnh1201/caterpillar.git
synced 2025-09-08 18:59:34 +00:00
108 lines
4.7 KiB
Python
108 lines
4.7 KiB
Python
#!/usr/bin/python3
|
|
#
|
|
# bio.py
|
|
# Biopython plugin for Caterpillar Proxy
|
|
#
|
|
# Euiseo Cha (Wonkwang University) <zeroday0619_dev@outlook.com>
|
|
# https://github.com/gnh1201/caterpillar
|
|
# Created at: 2024-07-02
|
|
# Updated at: 2024-07-02
|
|
#
|
|
|
|
import json
|
|
from Bio.Seq import Seq
|
|
from Bio.SeqUtils import gc_fraction
|
|
|
|
from base import Extension
|
|
|
|
def _analyze_sequence(sequence) -> dict[str, str]:
|
|
"""
|
|
Analyze a given DNA sequence to provide various nucleotide transformations and translations.
|
|
|
|
:param sequence: DNA sequence (string) to be analyzed.
|
|
:return: Dictionary containing the following analyses of the sequence:
|
|
- complement: DNA complement of the sequence.
|
|
- complement_rna: RNA complement of the sequence.
|
|
- reverse_complement: Reverse complement of the DNA sequence.
|
|
- reverse_complement_rna: Reverse complement of the RNA sequence.
|
|
- transcription: Transcription of the DNA sequence to RNA.
|
|
- translation: Translation of the RNA sequence to an amino acid sequence.
|
|
- back_transcribe: Back-transcription of the RNA sequence to DNA.
|
|
"""
|
|
sequence_object = Seq(sequence)
|
|
return dict(
|
|
complement=str(sequence_object.complement()),
|
|
complement_rna=str(sequence_object.complement_rna()),
|
|
reverse_complement=str(sequence_object.reverse_complement()),
|
|
reverse_complement_rna=str(sequence_object.reverse_complement_rna()),
|
|
transcription=str(sequence_object.transcribe()),
|
|
translation=str(sequence_object.translate()),
|
|
back_transcribe=str(sequence_object.back_transcribe()),
|
|
)
|
|
|
|
|
|
def _gc_content_calculation(sequence) -> dict[str, str]:
|
|
"""
|
|
Calculate the GC content of a given DNA sequence and return it as a float.
|
|
|
|
:param sequence: DNA sequence (string) for which to calculate the GC content.
|
|
:return: Dictionary containing the GC content as a float.
|
|
"""
|
|
gc_content = gc_fraction(sequence)
|
|
return dict(
|
|
gc_content=gc_content,
|
|
)
|
|
|
|
|
|
class PyBio(Extension):
|
|
def __init__(self):
|
|
self.type = "rpcmethod"
|
|
self.method = "analyze_sequence_init"
|
|
self.exported_methods = ["analyze_sequence", "gc_content_calculation"]
|
|
|
|
def dispatch(self, type, id, params, conn):
|
|
conn.send(b'Greeting! dispatch')
|
|
|
|
def analyze_sequence(self, type, id, params, conn):
|
|
"""
|
|
Analyze a DNA sequence provided in the params dictionary.
|
|
|
|
:param type: Not used in this function.
|
|
:param id: Not used in this function.
|
|
:param params: Dictionary containing the DNA sequence with the key "sequence".
|
|
Example: {"sequence": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT"}
|
|
:param conn: Not used in this function.
|
|
:return: Dictionary containing various analyses of the DNA sequence:
|
|
- back_transcribe: Back-transcription of the RNA sequence to DNA.
|
|
- complement: DNA complement of the sequence.
|
|
- complement_rna: RNA complement of the sequence.
|
|
- reverse_complement: Reverse complement of the DNA sequence.
|
|
- reverse_complement_rna: Reverse complement of the RNA sequence.
|
|
- transcription: Transcription of the DNA sequence to RNA.
|
|
- translation: Translation of the RNA sequence to an amino acid sequence.
|
|
Example: {"back_transcribe": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT",
|
|
"complement": "TACGCATGCATCGATCGATCGCATCGATCGACTGA",
|
|
"complement_rna": "UACGCAUGCAUCGAUCGAUCGCAUCGAUCGACUGA",
|
|
"reverse_complement": "AGTCAGCTAGCTACGCTAGCTAGCTACGTACGCAT",
|
|
"reverse_complement_rna": "AGUCAGCUAGCUACGCUAGCUAGCUACGUACGCAU",
|
|
"transcription": "AUGCGUACGUAGCUAGCUAGCGUAGCUAGCUGACU",
|
|
"translation": "MRT*LASVAS*"}
|
|
"""
|
|
result = _analyze_sequence(params['sequence'])
|
|
return result
|
|
|
|
def gc_content_calculation(self, type, id, params, conn):
|
|
"""
|
|
Calculate the GC content for a given DNA sequence provided in the params dictionary.
|
|
|
|
:param type: Not used in this function.
|
|
:param id: Not used in this function.
|
|
:param params: Dictionary containing the DNA sequence with the key "sequence".
|
|
Example: {"sequence": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT"}
|
|
:param conn: Not used in this function.
|
|
:return: Dictionary containing the GC content as a float.
|
|
Example: {"gc_content": 0.5142857142857142}
|
|
"""
|
|
result = _gc_content_calculation(params['sequence'])
|
|
return result
|