diff --git a/.gitignore b/.gitignore index 5affbb6..f943f1a 100644 --- a/.gitignore +++ b/.gitignore @@ -2,6 +2,7 @@ certs/ savedfiles/ settings.ini .env +*.crt ### Python ### # Byte-compiled / optimized / DLL files diff --git a/README.md b/README.md index 13b2fab..710be35 100644 --- a/README.md +++ b/README.md @@ -36,6 +36,7 @@ CERT_KEY=cert.key CERT_DIR=certs/ OPENSSL_BINPATH=openssl CLIENT_ENCODING=utf-8 +USE_EXTENSIONS=wayback.Wayback,bio.PyBio ``` - (Optional) Create a certificate for SSL decryption diff --git a/base.py b/base.py index c2406e8..47fcb50 100644 --- a/base.py +++ b/base.py @@ -3,16 +3,17 @@ # base.py # base (common) file # -# Caterpillar Proxy - The simple and parasitic web proxy SPAM spam filter +# Caterpillar Proxy - The simple web debugging proxy (formerly, php-httpproxy) # Namyheon Go (Catswords Research) # https://github.com/gnh1201/caterpillar # Created at: 2024-05-20 -# Updated at: 2024-05-21 +# Updated at: 2024-07-09 # import hashlib import json import re +import importlib client_encoding = 'utf-8' @@ -71,8 +72,16 @@ class Extension(): cls.buffer_size = _buffer_size @classmethod - def register(cls, f): - cls.extensions.append(f) + def register(cls, s): + module_name, class_name = s.strip().split('.')[0:2] + module_path = 'plugins.' + module_name + + try: + module = importlib.import_module(module_path) + _class = getattr(module, class_name) + cls.extensions.append(_class()) + except (ImportError, AttributeError) as e: + raise ImportError(class_name + " in the extension " + module_name) @classmethod def get_filters(cls): diff --git a/plugins/bio.py b/plugins/bio.py new file mode 100644 index 0000000..57e821e --- /dev/null +++ b/plugins/bio.py @@ -0,0 +1,107 @@ +#!/usr/bin/python3 +# +# bio.py +# Biopython plugin for Caterpillar Proxy +# +# Euiseo Cha (Wonkwang University) +# https://github.com/gnh1201/caterpillar +# Created at: 2024-07-02 +# Updated at: 2024-07-02 +# + +import json +from Bio.Seq import Seq +from Bio.SeqUtils import gc_fraction + +from base import Extension + +def _analyze_sequence(sequence) -> dict[str, str]: + """ + Analyze a given DNA sequence to provide various nucleotide transformations and translations. + + :param sequence: DNA sequence (string) to be analyzed. + :return: Dictionary containing the following analyses of the sequence: + - complement: DNA complement of the sequence. + - complement_rna: RNA complement of the sequence. + - reverse_complement: Reverse complement of the DNA sequence. + - reverse_complement_rna: Reverse complement of the RNA sequence. + - transcription: Transcription of the DNA sequence to RNA. + - translation: Translation of the RNA sequence to an amino acid sequence. + - back_transcribe: Back-transcription of the RNA sequence to DNA. + """ + sequence_object = Seq(sequence) + return dict( + complement=str(sequence_object.complement()), + complement_rna=str(sequence_object.complement_rna()), + reverse_complement=str(sequence_object.reverse_complement()), + reverse_complement_rna=str(sequence_object.reverse_complement_rna()), + transcription=str(sequence_object.transcribe()), + translation=str(sequence_object.translate()), + back_transcribe=str(sequence_object.back_transcribe()), + ) + + +def _gc_content_calculation(sequence) -> dict[str, str]: + """ + Calculate the GC content of a given DNA sequence and return it as a float. + + :param sequence: DNA sequence (string) for which to calculate the GC content. + :return: Dictionary containing the GC content as a float. + """ + gc_content = gc_fraction(sequence) + return dict( + gc_content=gc_content, + ) + + +class PyBio(Extension): + def __init__(self): + self.type = "rpcmethod" + self.method = "analyze_sequence_init" + self.exported_methods = ["analyze_sequence", "gc_content_calculation"] + + def dispatch(self, type, id, params, conn): + conn.send(b'Greeting! dispatch') + + def analyze_sequence(self, type, id, params, conn): + """ + Analyze a DNA sequence provided in the params dictionary. + + :param type: Not used in this function. + :param id: Not used in this function. + :param params: Dictionary containing the DNA sequence with the key "sequence". + Example: {"sequence": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT"} + :param conn: Not used in this function. + :return: Dictionary containing various analyses of the DNA sequence: + - back_transcribe: Back-transcription of the RNA sequence to DNA. + - complement: DNA complement of the sequence. + - complement_rna: RNA complement of the sequence. + - reverse_complement: Reverse complement of the DNA sequence. + - reverse_complement_rna: Reverse complement of the RNA sequence. + - transcription: Transcription of the DNA sequence to RNA. + - translation: Translation of the RNA sequence to an amino acid sequence. + Example: {"back_transcribe": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT", + "complement": "TACGCATGCATCGATCGATCGCATCGATCGACTGA", + "complement_rna": "UACGCAUGCAUCGAUCGAUCGCAUCGAUCGACUGA", + "reverse_complement": "AGTCAGCTAGCTACGCTAGCTAGCTACGTACGCAT", + "reverse_complement_rna": "AGUCAGCUAGCUACGCUAGCUAGCUACGUACGCAU", + "transcription": "AUGCGUACGUAGCUAGCUAGCGUAGCUAGCUGACU", + "translation": "MRT*LASVAS*"} + """ + result = _analyze_sequence(params['sequence']) + return result + + def gc_content_calculation(self, type, id, params, conn): + """ + Calculate the GC content for a given DNA sequence provided in the params dictionary. + + :param type: Not used in this function. + :param id: Not used in this function. + :param params: Dictionary containing the DNA sequence with the key "sequence". + Example: {"sequence": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT"} + :param conn: Not used in this function. + :return: Dictionary containing the GC content as a float. + Example: {"gc_content": 0.5142857142857142} + """ + result = _gc_content_calculation(params['sequence']) + return result diff --git a/plugins/container.py b/plugins/container.py index 11dbbb4..b2f6429 100644 --- a/plugins/container.py +++ b/plugins/container.py @@ -7,12 +7,12 @@ # Namyheon Go (Catswords Research) # https://github.com/gnh1201/caterpillar # Created at: 2024-03-04 -# Updated at: 2024-03-13 +# Updated at: 2024-07-06 # import docker -from server import Extension +from base import Extension class Container(Extension): def __init__(self): diff --git a/plugins/fediverse.py b/plugins/fediverse.py index f6f910b..7dcd6d4 100644 --- a/plugins/fediverse.py +++ b/plugins/fediverse.py @@ -8,7 +8,7 @@ # https://github.com/gnh1201/caterpillar # # Created in: 2022-10-06 -# Updated in: 2024-06-05 +# Updated in: 2024-07-06 # import io @@ -19,7 +19,7 @@ import os.path from decouple import config from PIL import Image -from server import Extension +from base import Extension try: client_encoding = config('CLIENT_ENCODING', default='utf-8') diff --git a/plugins/nmap.py b/plugins/nmap.py new file mode 100644 index 0000000..ecf0238 --- /dev/null +++ b/plugins/nmap.py @@ -0,0 +1,34 @@ +#!/usr/bin/python3 +# +# portscan.py +# NMAP port scanning wrapper for Caterpillar Proxy +# +# Caterpillar Proxy - The simple web debugging proxy (formerly, php-httpproxy) +# Namyheon Go (Catswords Research) +# https://github.com/gnh1201/caterpillar +# Created at: 2022-01-26 (github.com/gnh1201/welsonjs) +# Updated at: 2024-07-09 +# +import sys +import nmap +import json + +from base import Extension + +class PortScanner(Extension): + def __init__(self): + self.type = "rpcmethod" + self.method = "scan_ports_by_hosts" + self.exported_methods = [] + + def dispatch(self, type, id, params, conn): + hosts = params['hosts'] + binpath = params['binpath'] + + nm = nmap.PortScanner(nmap_search_path=(binpath,)) + result = nm.scan(hosts=hosts, arguments='-T5 -sV -p0-65535 --max-retries 0') + + return result; + +if __name__ == "__main__": + main(sys.argv) diff --git a/plugins/wayback.py b/plugins/wayback.py index 51da3b9..cace667 100644 --- a/plugins/wayback.py +++ b/plugins/wayback.py @@ -7,12 +7,13 @@ # Namyheon Go (Catswords Research) # https://github.com/gnh1201/caterpillar # Created at: 2024-03-13 -# Updated at: 2024-03-13 +# Updated at: 2024-07-06 # import requests +from decouple import config -from server import Extension +from base import Extension try: client_encoding = config('CLIENT_ENCODING') diff --git a/server.py b/server.py index 11b4649..b5679c8 100644 --- a/server.py +++ b/server.py @@ -7,7 +7,7 @@ # Namyheon Go (Catswords Research) # https://github.com/gnh1201/caterpillar # Created at: 2022-10-06 -# Updated at: 2024-06-20 +# Updated at: 2024-07-09 # import argparse @@ -23,7 +23,6 @@ import time import hashlib import traceback import textwrap -import importlib from datetime import datetime from platform import python_version @@ -48,6 +47,7 @@ try: client_encoding = config('CLIENT_ENCODING', default='utf-8') local_domain = config('LOCAL_DOMAIN', default='') proxy_pass = config('PROXY_PASS', default='') + use_extensions = config('USE_EXTENSIONS', default='') except KeyboardInterrupt: print("\n[*] User has requested an interrupt") print("[*] Application Exiting.....") @@ -499,9 +499,8 @@ def start(): #Main Program if __name__== "__main__": # load extensions - #Extension.register(importlib.import_module("plugins.fediverse").Fediverse()) - #Extension.register(importlib.import_module("plugins.container").Container()) - #Extension.register(importlib.import_module("plugins.wayback").Wayback()) - + for s in use_extensions.split(','): + Extension.register(s) + # start Caterpillar start() diff --git a/web.py b/web.py index 236651e..6e4affa 100644 --- a/web.py +++ b/web.py @@ -7,7 +7,7 @@ # Namyheon Go (Catswords Research) # https://github.com/gnh1201/caterpillar # Created at: 2024-05-20 -# Updated at: 2024-05-20 +# Updated at: 2024-07-10 # from flask import Flask, request, redirect, url_for, render_template @@ -94,6 +94,7 @@ if __name__ == "__main__": Extension.set_protocol('http') # load extensions - #Extension.register(importlib.import_module("plugins.yourownplugin").YourOwnPlugin()) + for s in use_extensions.split(','): + Extension.register(s) app.run(debug=True, host='0.0.0.0', port=listening_port)