From 9133f75c38d67f360d793ea0d8a576e1380857aa Mon Sep 17 00:00:00 2001
From: Euiseo Cha <zeroday0619_dev@outlook.com>
Date: Fri, 5 Jul 2024 20:50:39 +0900
Subject: [PATCH] feat: removed unnecessary code and added comments

---
 plugins/bio.py | 55 +++++++++++++++++++++++++++++++++++++++++++++++++-
 1 file changed, 54 insertions(+), 1 deletion(-)

diff --git a/plugins/bio.py b/plugins/bio.py
index d580d0a..568df2b 100644
--- a/plugins/bio.py
+++ b/plugins/bio.py
@@ -17,6 +17,19 @@ from server import Extension
 
 
 def _analyze_sequence(sequence) -> dict[str, str]:
+    """
+    Analyze a given DNA sequence to provide various nucleotide transformations and translations.
+
+    :param sequence: DNA sequence (string) to be analyzed.
+    :return: Dictionary containing the following analyses of the sequence:
+             - complement: DNA complement of the sequence.
+             - complement_rna: RNA complement of the sequence.
+             - reverse_complement: Reverse complement of the DNA sequence.
+             - reverse_complement_rna: Reverse complement of the RNA sequence.
+             - transcription: Transcription of the DNA sequence to RNA.
+             - translation: Translation of the RNA sequence to an amino acid sequence.
+             - back_transcribe: Back-transcription of the RNA sequence to DNA.
+    """
     sequence_object = Seq(sequence)
     return dict(
         complement=str(sequence_object.complement()),
@@ -30,6 +43,12 @@ def _analyze_sequence(sequence) -> dict[str, str]:
 
 
 def _gc_content_calculation(sequence) -> dict[str, str]:
+    """
+    Calculate the GC content of a given DNA sequence and return it as a float.
+
+    :param sequence: DNA sequence (string) for which to calculate the GC content.
+    :return: Dictionary containing the GC content as a float.
+    """
     gc_content = gc_fraction(sequence)
     return dict(
         gc_content=gc_content,
@@ -43,13 +62,47 @@ class PyBio(Extension):
         self.exported_methods = ["analyze_sequence", "gc_content_calculation"]
 
     def dispatch(self, type, id, params, conn):
-        print("[*] Greeting! dispatch")
         conn.send(b'Greeting! dispatch')
 
     def analyze_sequence(self, type, id, params, conn):
+        """
+        Analyze a DNA sequence provided in the params dictionary.
+
+        :param type: Not used in this function.
+        :param id: Not used in this function.
+        :param params: Dictionary containing the DNA sequence with the key "sequence".
+                       Example: {"sequence": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT"}
+        :param conn: Not used in this function.
+        :return: Dictionary containing various analyses of the DNA sequence:
+                 - back_transcribe: Back-transcription of the RNA sequence to DNA.
+                 - complement: DNA complement of the sequence.
+                 - complement_rna: RNA complement of the sequence.
+                 - reverse_complement: Reverse complement of the DNA sequence.
+                 - reverse_complement_rna: Reverse complement of the RNA sequence.
+                 - transcription: Transcription of the DNA sequence to RNA.
+                 - translation: Translation of the RNA sequence to an amino acid sequence.
+                 Example: {"back_transcribe": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT",
+                           "complement": "TACGCATGCATCGATCGATCGCATCGATCGACTGA",
+                           "complement_rna": "UACGCAUGCAUCGAUCGAUCGCAUCGAUCGACUGA",
+                           "reverse_complement": "AGTCAGCTAGCTACGCTAGCTAGCTACGTACGCAT",
+                           "reverse_complement_rna": "AGUCAGCUAGCUACGCUAGCUAGCUACGUACGCAU",
+                           "transcription": "AUGCGUACGUAGCUAGCUAGCGUAGCUAGCUGACU",
+                           "translation": "MRT*LASVAS*"}
+        """
         result = _analyze_sequence(params['sequence'])
         return result
 
     def gc_content_calculation(self, type, id, params, conn):
+        """
+        Calculate the GC content for a given DNA sequence provided in the params dictionary.
+
+        :param type: Not used in this function.
+        :param id: Not used in this function.
+        :param params: Dictionary containing the DNA sequence with the key "sequence".
+                       Example: {"sequence": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT"}
+        :param conn: Not used in this function.
+        :return: Dictionary containing the GC content as a float.
+                 Example: {"gc_content": 0.5142857142857142}
+        """
         result = _gc_content_calculation(params['sequence'])
         return result