mirror of
https://github.com/gnh1201/caterpillar.git
synced 2025-05-12 04:31:06 +00:00
Remove all plug-ins
This commit is contained in:
parent
a7371b1fa2
commit
acc6393658
|
@ -1,223 +0,0 @@
|
||||||
#!/usr/bin/python3
|
|
||||||
#
|
|
||||||
# alwaysonline.py
|
|
||||||
# Always Online implementation for Caterpillar Proxy
|
|
||||||
#
|
|
||||||
# Caterpillar Proxy - The simple web debugging proxy (formerly, php-httpproxy)
|
|
||||||
# Namyheon Go (Catswords Research) <gnh1201@gmail.com>
|
|
||||||
# https://github.com/gnh1201/caterpillar
|
|
||||||
# Created at: 2024-07-31
|
|
||||||
# Updated at: 2024-07-31
|
|
||||||
#
|
|
||||||
import socket
|
|
||||||
import ssl
|
|
||||||
import requests
|
|
||||||
from decouple import config
|
|
||||||
from elasticsearch import Elasticsearch, NotFoundError
|
|
||||||
import hashlib
|
|
||||||
from datetime import datetime, UTC
|
|
||||||
from base import Extension, Logger
|
|
||||||
|
|
||||||
logger = Logger(name="wayback")
|
|
||||||
|
|
||||||
try:
|
|
||||||
client_encoding = config("CLIENT_ENCODING")
|
|
||||||
es_host = config("ES_HOST")
|
|
||||||
es_index = config("ES_INDEX")
|
|
||||||
except Exception as e:
|
|
||||||
logger.error("[*] Invalid configuration", exc_info=e)
|
|
||||||
|
|
||||||
es = Elasticsearch([es_host])
|
|
||||||
|
|
||||||
|
|
||||||
def generate_id(url: str):
|
|
||||||
"""Generate a unique ID for a URL by hashing it."""
|
|
||||||
return hashlib.sha256(url.encode("utf-8")).hexdigest()
|
|
||||||
|
|
||||||
|
|
||||||
def get_cached_page_from_google(url: str):
|
|
||||||
status_code, content = (0, b"")
|
|
||||||
|
|
||||||
# Google Cache URL
|
|
||||||
google_cache_url = "https://webcache.googleusercontent.com/search?q=cache:" + url
|
|
||||||
|
|
||||||
# Send a GET request to Google Cache URL
|
|
||||||
response = requests.get(google_cache_url)
|
|
||||||
|
|
||||||
# Check if the request was successful (status code 200)
|
|
||||||
if response.status_code == 200:
|
|
||||||
content = response.content # Extract content from response
|
|
||||||
else:
|
|
||||||
status_code = response.status_code
|
|
||||||
|
|
||||||
return status_code, content
|
|
||||||
|
|
||||||
|
|
||||||
# API documentation: https://archive.org/help/wayback_api.php
|
|
||||||
def get_cached_page_from_wayback(url: str):
|
|
||||||
status_code, content = (0, b"")
|
|
||||||
|
|
||||||
# Wayback Machine API URL
|
|
||||||
wayback_api_url = "http://archive.org/wayback/available?url=" + url
|
|
||||||
|
|
||||||
# Send a GET request to Wayback Machine API
|
|
||||||
response = requests.get(wayback_api_url)
|
|
||||||
|
|
||||||
# Check if the request was successful (status code 200)
|
|
||||||
if response.status_code == 200:
|
|
||||||
try:
|
|
||||||
# Parse JSON response
|
|
||||||
data = response.json()
|
|
||||||
archived_snapshots = data.get("archived_snapshots", {})
|
|
||||||
closest_snapshot = archived_snapshots.get("closest", {})
|
|
||||||
|
|
||||||
# Check if the URL is available in the archive
|
|
||||||
if closest_snapshot:
|
|
||||||
archived_url = closest_snapshot.get("url", "")
|
|
||||||
|
|
||||||
# If URL is available, fetch the content of the archived page
|
|
||||||
if archived_url:
|
|
||||||
archived_page_response = requests.get(archived_url)
|
|
||||||
status_code = archived_page_response.status_code
|
|
||||||
if status_code == 200:
|
|
||||||
content = archived_page_response.content
|
|
||||||
else:
|
|
||||||
status_code = 404
|
|
||||||
else:
|
|
||||||
status_code = 404
|
|
||||||
except:
|
|
||||||
status_code = 502
|
|
||||||
else:
|
|
||||||
status_code = response.status_code
|
|
||||||
|
|
||||||
return status_code, content
|
|
||||||
|
|
||||||
|
|
||||||
def get_cached_page_from_elasticsearch(url: str):
|
|
||||||
url_id = generate_id(url)
|
|
||||||
try:
|
|
||||||
result = es.get(index=es_index, id=url_id)
|
|
||||||
logger.info(result["_source"])
|
|
||||||
return 200, result["_source"]["content"].encode(client_encoding)
|
|
||||||
except NotFoundError:
|
|
||||||
return 404, b""
|
|
||||||
except Exception as e:
|
|
||||||
logger.error(f"Error fetching from Elasticsearch: {e}")
|
|
||||||
return 502, b""
|
|
||||||
|
|
||||||
|
|
||||||
def cache_to_elasticsearch(url: str, data: bytes):
|
|
||||||
url_id = generate_id(url)
|
|
||||||
timestamp = datetime.now(UTC).timestamp()
|
|
||||||
try:
|
|
||||||
es.index(
|
|
||||||
index=es_index,
|
|
||||||
id=url_id,
|
|
||||||
body={
|
|
||||||
"url": url,
|
|
||||||
"content": data.decode(client_encoding),
|
|
||||||
"timestamp": timestamp,
|
|
||||||
},
|
|
||||||
)
|
|
||||||
except Exception as e:
|
|
||||||
logger.error(f"Error caching to Elasticsearch: {e}")
|
|
||||||
|
|
||||||
|
|
||||||
def get_page_from_origin_server(url: str):
|
|
||||||
try:
|
|
||||||
response = requests.get(url)
|
|
||||||
return response.status_code, response.content
|
|
||||||
except Exception as e:
|
|
||||||
return 502, str(e).encode(client_encoding)
|
|
||||||
|
|
||||||
|
|
||||||
class AlwaysOnline(Extension):
|
|
||||||
def __init__(self):
|
|
||||||
self.type = "connector" # this is a connector
|
|
||||||
self.connection_type = "alwaysonline"
|
|
||||||
self.buffer_size = 8192
|
|
||||||
|
|
||||||
def connect(self, conn: socket.socket, data: bytes, webserver: bytes, port: bytes, scheme: bytes, method: bytes, url: bytes):
|
|
||||||
logger.info("[*] Connecting... Connecting...")
|
|
||||||
|
|
||||||
connected = False
|
|
||||||
|
|
||||||
is_ssl = scheme in [b"https", b"tls", b"ssl"]
|
|
||||||
cache_hit = 0
|
|
||||||
buffered = b""
|
|
||||||
|
|
||||||
def sendall(_sock: socket.socket, _conn: socket.socket, _data: bytes):
|
|
||||||
# send first chuck
|
|
||||||
sock.send(_data)
|
|
||||||
if len(_data) < self.buffer_size:
|
|
||||||
return
|
|
||||||
|
|
||||||
# send following chunks
|
|
||||||
_conn.settimeout(1)
|
|
||||||
while True:
|
|
||||||
try:
|
|
||||||
chunk = _conn.recv(self.buffer_size)
|
|
||||||
if not chunk:
|
|
||||||
break
|
|
||||||
_sock.send(chunk)
|
|
||||||
except:
|
|
||||||
break
|
|
||||||
|
|
||||||
target_url = url.decode(client_encoding)
|
|
||||||
target_scheme = scheme.decode(client_encoding)
|
|
||||||
target_webserver = webserver.decode(client_encoding)
|
|
||||||
|
|
||||||
if "://" not in target_url:
|
|
||||||
target_url = f"{target_scheme}://{target_webserver}:{port}{target_url}"
|
|
||||||
|
|
||||||
if method == b"GET":
|
|
||||||
if not connected:
|
|
||||||
logger.info("Trying get data from Elasticsearch...")
|
|
||||||
status_code, content = get_cached_page_from_elasticsearch(target_url)
|
|
||||||
if status_code == 200:
|
|
||||||
buffered += content
|
|
||||||
cache_hit += 1
|
|
||||||
connected = True
|
|
||||||
|
|
||||||
if not connected:
|
|
||||||
logger.info("Trying get data from Wayback Machine...")
|
|
||||||
status_code, content = get_cached_page_from_wayback(target_url)
|
|
||||||
if status_code == 200:
|
|
||||||
buffered += content
|
|
||||||
cache_hit += 1
|
|
||||||
connected = True
|
|
||||||
|
|
||||||
if not connected:
|
|
||||||
logger.info("Trying get data from Google Website Cache...")
|
|
||||||
status_code, content = get_cached_page_from_google(target_url)
|
|
||||||
if status_code == 200:
|
|
||||||
buffered += content
|
|
||||||
cache_hit += 1
|
|
||||||
connected = True
|
|
||||||
|
|
||||||
if cache_hit == 0:
|
|
||||||
status_code, content = get_page_from_origin_server(target_url)
|
|
||||||
buffered += content
|
|
||||||
cache_to_elasticsearch(target_url, buffered)
|
|
||||||
|
|
||||||
conn.send(buffered)
|
|
||||||
else:
|
|
||||||
sock = socket.socket(socket.AF_INET, socket.SOCK_STREAM)
|
|
||||||
|
|
||||||
if is_ssl:
|
|
||||||
context = ssl.create_default_context()
|
|
||||||
context.check_hostname = False
|
|
||||||
context.verify_mode = ssl.CERT_NONE
|
|
||||||
|
|
||||||
sock = context.wrap_socket(
|
|
||||||
sock, server_hostname=webserver.decode(client_encoding)
|
|
||||||
)
|
|
||||||
sock.connect((webserver, port))
|
|
||||||
# sock.sendall(data)
|
|
||||||
sendall(sock, conn, data)
|
|
||||||
else:
|
|
||||||
sock.connect((webserver, port))
|
|
||||||
# sock.sendall(data)
|
|
||||||
sendall(sock, conn, data)
|
|
||||||
|
|
||||||
return connected
|
|
108
plugins/bio.py
108
plugins/bio.py
|
@ -1,108 +0,0 @@
|
||||||
#!/usr/bin/python3
|
|
||||||
#
|
|
||||||
# bio.py
|
|
||||||
# Biopython plugin for Caterpillar Proxy
|
|
||||||
#
|
|
||||||
# Euiseo Cha (Wonkwang University) <zeroday0619_dev@outlook.com>
|
|
||||||
# https://github.com/gnh1201/caterpillar
|
|
||||||
# Created at: 2024-07-02
|
|
||||||
# Updated at: 2024-07-02
|
|
||||||
#
|
|
||||||
|
|
||||||
from socket import socket
|
|
||||||
from Bio.Seq import Seq
|
|
||||||
from Bio.SeqUtils import gc_fraction
|
|
||||||
|
|
||||||
from base import Extension
|
|
||||||
|
|
||||||
|
|
||||||
def _analyze_sequence(sequence: str) -> dict[str, str]:
|
|
||||||
"""
|
|
||||||
Analyze a given DNA sequence to provide various nucleotide transformations and translations.
|
|
||||||
|
|
||||||
:param sequence: DNA sequence (string) to be analyzed.
|
|
||||||
:return: Dictionary containing the following analyses of the sequence:
|
|
||||||
- complement: DNA complement of the sequence.
|
|
||||||
- complement_rna: RNA complement of the sequence.
|
|
||||||
- reverse_complement: Reverse complement of the DNA sequence.
|
|
||||||
- reverse_complement_rna: Reverse complement of the RNA sequence.
|
|
||||||
- transcription: Transcription of the DNA sequence to RNA.
|
|
||||||
- translation: Translation of the RNA sequence to an amino acid sequence.
|
|
||||||
- back_transcribe: Back-transcription of the RNA sequence to DNA.
|
|
||||||
"""
|
|
||||||
sequence_object = Seq(sequence)
|
|
||||||
return dict(
|
|
||||||
complement=str(sequence_object.complement()),
|
|
||||||
complement_rna=str(sequence_object.complement_rna()),
|
|
||||||
reverse_complement=str(sequence_object.reverse_complement()),
|
|
||||||
reverse_complement_rna=str(sequence_object.reverse_complement_rna()),
|
|
||||||
transcription=str(sequence_object.transcribe()),
|
|
||||||
translation=str(sequence_object.translate()),
|
|
||||||
back_transcribe=str(sequence_object.back_transcribe()),
|
|
||||||
)
|
|
||||||
|
|
||||||
|
|
||||||
def _gc_content_calculation(sequence: str) -> dict[str, str]:
|
|
||||||
"""
|
|
||||||
Calculate the GC content of a given DNA sequence and return it as a float.
|
|
||||||
|
|
||||||
:param sequence: DNA sequence (string) for which to calculate the GC content.
|
|
||||||
:return: Dictionary containing the GC content as a float.
|
|
||||||
"""
|
|
||||||
gc_content = gc_fraction(sequence)
|
|
||||||
return dict(
|
|
||||||
gc_content=gc_content,
|
|
||||||
)
|
|
||||||
|
|
||||||
|
|
||||||
class PyBio(Extension):
|
|
||||||
def __init__(self):
|
|
||||||
self.type = "rpcmethod"
|
|
||||||
self.method = "analyze_sequence_init"
|
|
||||||
self.exported_methods = ["analyze_sequence", "gc_content_calculation"]
|
|
||||||
|
|
||||||
def dispatch(self, type, id, params, conn):
|
|
||||||
conn.send(b"Greeting! dispatch")
|
|
||||||
|
|
||||||
def analyze_sequence(self, type, id, params, conn: socket):
|
|
||||||
"""
|
|
||||||
Analyze a DNA sequence provided in the params dictionary.
|
|
||||||
|
|
||||||
:param type: Not used in this function.
|
|
||||||
:param id: Not used in this function.
|
|
||||||
:param params: Dictionary containing the DNA sequence with the key "sequence".
|
|
||||||
Example: {"sequence": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT"}
|
|
||||||
:param conn: Not used in this function.
|
|
||||||
:return: Dictionary containing various analyses of the DNA sequence:
|
|
||||||
- back_transcribe: Back-transcription of the RNA sequence to DNA.
|
|
||||||
- complement: DNA complement of the sequence.
|
|
||||||
- complement_rna: RNA complement of the sequence.
|
|
||||||
- reverse_complement: Reverse complement of the DNA sequence.
|
|
||||||
- reverse_complement_rna: Reverse complement of the RNA sequence.
|
|
||||||
- transcription: Transcription of the DNA sequence to RNA.
|
|
||||||
- translation: Translation of the RNA sequence to an amino acid sequence.
|
|
||||||
Example: {"back_transcribe": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT",
|
|
||||||
"complement": "TACGCATGCATCGATCGATCGCATCGATCGACTGA",
|
|
||||||
"complement_rna": "UACGCAUGCAUCGAUCGAUCGCAUCGAUCGACUGA",
|
|
||||||
"reverse_complement": "AGTCAGCTAGCTACGCTAGCTAGCTACGTACGCAT",
|
|
||||||
"reverse_complement_rna": "AGUCAGCUAGCUACGCUAGCUAGCUACGUACGCAU",
|
|
||||||
"transcription": "AUGCGUACGUAGCUAGCUAGCGUAGCUAGCUGACU",
|
|
||||||
"translation": "MRT*LASVAS*"}
|
|
||||||
"""
|
|
||||||
result = _analyze_sequence(params["sequence"])
|
|
||||||
return result
|
|
||||||
|
|
||||||
def gc_content_calculation(self, type, id, params, conn: socket):
|
|
||||||
"""
|
|
||||||
Calculate the GC content for a given DNA sequence provided in the params dictionary.
|
|
||||||
|
|
||||||
:param type: Not used in this function.
|
|
||||||
:param id: Not used in this function.
|
|
||||||
:param params: Dictionary containing the DNA sequence with the key "sequence".
|
|
||||||
Example: {"sequence": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT"}
|
|
||||||
:param conn: Not used in this function.
|
|
||||||
:return: Dictionary containing the GC content as a float.
|
|
||||||
Example: {"gc_content": 0.5142857142857142}
|
|
||||||
"""
|
|
||||||
result = _gc_content_calculation(params["sequence"])
|
|
||||||
return result
|
|
|
@ -1,112 +0,0 @@
|
||||||
#!/usr/bin/python3
|
|
||||||
#
|
|
||||||
# container.py
|
|
||||||
# Linux Container (e.g. Docker) plugin for Caterpillar Proxy
|
|
||||||
#
|
|
||||||
# Caterpillar Proxy - The simple and parasitic web proxy with SPAM filter
|
|
||||||
# Namyheon Go (Catswords Research) <gnh1201@gmail.com>
|
|
||||||
# https://github.com/gnh1201/caterpillar
|
|
||||||
# Created at: 2024-03-04
|
|
||||||
# Updated at: 2024-07-06
|
|
||||||
#
|
|
||||||
|
|
||||||
import docker
|
|
||||||
from socket import socket
|
|
||||||
from base import Extension, Logger
|
|
||||||
|
|
||||||
logger = Logger("Container")
|
|
||||||
|
|
||||||
|
|
||||||
class Container(Extension):
|
|
||||||
def __init__(self):
|
|
||||||
self.type = "rpcmethod"
|
|
||||||
self.method = "container_init"
|
|
||||||
self.exported_methods = [
|
|
||||||
"container_cteate",
|
|
||||||
"container_start",
|
|
||||||
"container_run",
|
|
||||||
"container_stop",
|
|
||||||
"container_pause",
|
|
||||||
"container_unpause",
|
|
||||||
"container_restart",
|
|
||||||
"container_kill",
|
|
||||||
"container_remove",
|
|
||||||
]
|
|
||||||
|
|
||||||
# docker
|
|
||||||
self.client = docker.from_env()
|
|
||||||
|
|
||||||
def dispatch(self, type, id, params, conn: socket):
|
|
||||||
logger.info("[*] Greeting! dispatch")
|
|
||||||
conn.send(b"Greeting! dispatch")
|
|
||||||
|
|
||||||
def container_cteate(self, type, id, params, conn: socket):
|
|
||||||
# todo: -
|
|
||||||
return b"[*] Created"
|
|
||||||
|
|
||||||
def container_start(self, type, id, params, conn: socket):
|
|
||||||
name = params["name"]
|
|
||||||
|
|
||||||
container = self.client.containers.get(name)
|
|
||||||
container.start()
|
|
||||||
|
|
||||||
def container_run(self, type, id, params, conn: socket):
|
|
||||||
devices = params["devices"]
|
|
||||||
image = params["image"]
|
|
||||||
devices = params["devices"]
|
|
||||||
name = params["name"]
|
|
||||||
environment = params["environment"]
|
|
||||||
volumes = params["volumes"]
|
|
||||||
|
|
||||||
container = self.client.containers.run(
|
|
||||||
image,
|
|
||||||
devices=devices,
|
|
||||||
name=name,
|
|
||||||
volumes=volumes,
|
|
||||||
environment=environment,
|
|
||||||
detach=True,
|
|
||||||
)
|
|
||||||
container.logs()
|
|
||||||
logger.info("[*] Running...")
|
|
||||||
return b"[*] Running..."
|
|
||||||
|
|
||||||
def container_stop(self, type, id, params, conn: socket):
|
|
||||||
name = params["name"]
|
|
||||||
|
|
||||||
container = self.client.containers.get(name)
|
|
||||||
container.stop()
|
|
||||||
|
|
||||||
logger.info("[*] Stopped")
|
|
||||||
return b"[*] Stopped"
|
|
||||||
|
|
||||||
def container_pause(self, type, id, params, conn: socket):
|
|
||||||
name = params["name"]
|
|
||||||
|
|
||||||
container = self.client.containers.get(name)
|
|
||||||
container.pause()
|
|
||||||
return b"[*] Paused"
|
|
||||||
|
|
||||||
def container_unpause(self, type, id, params, conn: socket):
|
|
||||||
name = params["name"]
|
|
||||||
|
|
||||||
container = self.client.containers.get(name)
|
|
||||||
container.unpause()
|
|
||||||
return b"[*] Unpaused"
|
|
||||||
|
|
||||||
def container_restart(self, type, id, params, conn: socket):
|
|
||||||
name = params["name"]
|
|
||||||
|
|
||||||
container = self.client.containers.get(name)
|
|
||||||
container.restart()
|
|
||||||
return b"[*] Restarted"
|
|
||||||
|
|
||||||
def container_kill(self, type, id, params, conn: socket):
|
|
||||||
# TODO: -
|
|
||||||
return b"[*] Killed"
|
|
||||||
|
|
||||||
def container_remove(self, type, id, params, conn: socket):
|
|
||||||
name = params["name"]
|
|
||||||
|
|
||||||
container = self.client.containers.get(name)
|
|
||||||
container.remove()
|
|
||||||
return b"[*] Removed"
|
|
|
@ -1,317 +0,0 @@
|
||||||
#!/usr/bin/python3
|
|
||||||
#
|
|
||||||
# fediverse.py
|
|
||||||
# Fediverse (Mastodon, Misskey, Pleroma, ...) SPAM filter plugin for Caterpillar Proxy
|
|
||||||
#
|
|
||||||
# Caterpillar Proxy - The simple and parasitic web proxy with SPAM filter (formerly, php-httpproxy)
|
|
||||||
# Namyheon Go (Catswords Research) <abuse@catswords.net>
|
|
||||||
# https://github.com/gnh1201/caterpillar
|
|
||||||
# https://github.com/gnh1201/caterpillar/wiki/Fediverse
|
|
||||||
#
|
|
||||||
# Created in: 2022-10-06
|
|
||||||
# Updated in: 2024-10-08
|
|
||||||
#
|
|
||||||
import base64
|
|
||||||
import hashlib
|
|
||||||
import io
|
|
||||||
import re
|
|
||||||
import requests
|
|
||||||
import os.path
|
|
||||||
import logging
|
|
||||||
|
|
||||||
from decouple import config
|
|
||||||
from PIL import Image
|
|
||||||
|
|
||||||
from base import Extension, Logger
|
|
||||||
|
|
||||||
logger = Logger(name="fediverse", level=logging.WARNING)
|
|
||||||
|
|
||||||
try:
|
|
||||||
client_encoding = config("CLIENT_ENCODING", default="utf-8")
|
|
||||||
truecaptcha_userid = config("TRUECAPTCHA_USERID") # truecaptcha.org
|
|
||||||
truecaptcha_apikey = config("TRUECAPTCHA_APIKEY") # truecaptcha.org
|
|
||||||
dictionary_file = config(
|
|
||||||
"DICTIONARY_FILE", default="words_alpha.txt"
|
|
||||||
) # https://github.com/dwyl/english-words
|
|
||||||
librey_apiurl = config(
|
|
||||||
"LIBREY_APIURL", default="https://serp.catswords.net"
|
|
||||||
) # https://github.com/Ahwxorg/librey
|
|
||||||
bad_domain = config("BAD_DOMAIN", default="")
|
|
||||||
except Exception as e:
|
|
||||||
logger.error("[*] Invalid configuration", exc_info=e)
|
|
||||||
|
|
||||||
class Fediverse(Extension):
|
|
||||||
def __init__(self):
|
|
||||||
self.type = "filter" # this is a filter
|
|
||||||
|
|
||||||
# Load data to use KnownWords4 strategy
|
|
||||||
# Download data: https://github.com/dwyl/english-words
|
|
||||||
self.known_words = []
|
|
||||||
if dictionary_file != "" and os.path.isfile(dictionary_file):
|
|
||||||
with open(dictionary_file, "r") as file:
|
|
||||||
words = file.readlines()
|
|
||||||
self.known_words = [
|
|
||||||
word.strip() for word in words if len(word.strip()) > 3
|
|
||||||
]
|
|
||||||
logger.info("[*] Data loaded to use KnownWords4 strategy")
|
|
||||||
|
|
||||||
def test(self, filtered, data, webserver, port, scheme, method, url):
|
|
||||||
# prevent cache confusing
|
|
||||||
if data.find(b"<title>Welcome to nginx!</title>") > -1:
|
|
||||||
return True
|
|
||||||
|
|
||||||
# allowed conditions
|
|
||||||
if method == b"GET" or url.find(b"/api") > -1:
|
|
||||||
return False
|
|
||||||
|
|
||||||
# convert to text
|
|
||||||
data_length = len(data)
|
|
||||||
text = data.decode(client_encoding, errors="ignore")
|
|
||||||
error_rate = (data_length - len(text)) / data_length
|
|
||||||
if error_rate > 0.2: # it is a binary data
|
|
||||||
return False
|
|
||||||
|
|
||||||
# check if the text contains any of the bad domains
|
|
||||||
bad_domains = list(filter(None, map(str.strip, bad_domain.split(","))))
|
|
||||||
if bool(re.search(r"https://(" + "|".join(re.escape(domain) for domain in bad_domains) + ")", text)):
|
|
||||||
logger.warning("[*] Found a bad reputation domain.")
|
|
||||||
logger.warning("[*] BLOCKED MESSAGE: %s" % (text))
|
|
||||||
return True
|
|
||||||
|
|
||||||
# check ID with K-Anonymity strategy
|
|
||||||
pattern = r"\b(?:(?<=\/@)|(?<=acct:))([a-zA-Z0-9]{10})\b"
|
|
||||||
matches = list(set(re.findall(pattern, text)))
|
|
||||||
if len(matches) > 0:
|
|
||||||
try:
|
|
||||||
filtered = not all(map(self.pwnedpasswords_test, matches))
|
|
||||||
if filtered:
|
|
||||||
logger.warning("[*] Found Suspicious ID: %s" % (", ".join(matches)))
|
|
||||||
except Exception as e:
|
|
||||||
logger.error("[*] K-Anonymity strategy not working!", exc_info=e)
|
|
||||||
filtered = True
|
|
||||||
|
|
||||||
# feedback
|
|
||||||
if filtered and len(matches) > 0:
|
|
||||||
score = 0
|
|
||||||
strategies = []
|
|
||||||
|
|
||||||
# check ID with VowelRatio10 strategy
|
|
||||||
def vowel_ratio_test(s):
|
|
||||||
ratio = self.calculate_vowel_ratio(s)
|
|
||||||
return ratio > 0.2 and ratio < 0.8
|
|
||||||
|
|
||||||
if all(map(vowel_ratio_test, matches)):
|
|
||||||
score += 1
|
|
||||||
strategies.append("VowelRatio10")
|
|
||||||
|
|
||||||
# check ID with Palindrome4 strategy
|
|
||||||
if all(map(self.has_palindrome, matches)):
|
|
||||||
score += 1
|
|
||||||
strategies.append("Palindrome4")
|
|
||||||
|
|
||||||
# check ID with KnownWords4 strategy
|
|
||||||
if all(map(self.has_known_word, matches)):
|
|
||||||
score += 2
|
|
||||||
strategies.append("KnownWords4")
|
|
||||||
|
|
||||||
# check ID with SearchEngine3 strategy
|
|
||||||
if librey_apiurl != "" and all(map(self.search_engine_test, matches)):
|
|
||||||
score += 1
|
|
||||||
strategies.append("SearchEngine3")
|
|
||||||
|
|
||||||
# check ID with RepeatedNumbers3 strategy
|
|
||||||
if all(map(self.repeated_numbers_test, matches)):
|
|
||||||
score += 1
|
|
||||||
strategies.append("RepeatedNumbers3")
|
|
||||||
|
|
||||||
# logging score
|
|
||||||
with open("score.log", "a") as file:
|
|
||||||
file.write(
|
|
||||||
"%s\t%s\t%s\r\n"
|
|
||||||
% ("+".join(matches), str(score), "+".join(strategies))
|
|
||||||
)
|
|
||||||
|
|
||||||
# make decision
|
|
||||||
if score > 1:
|
|
||||||
filtered = False
|
|
||||||
|
|
||||||
# check an attached images (check images with Not-CAPTCHA strategy)
|
|
||||||
if truecaptcha_userid != "" and not filtered and len(matches) > 0:
|
|
||||||
|
|
||||||
def webp_to_png_base64(url):
|
|
||||||
try:
|
|
||||||
response = requests.get(url)
|
|
||||||
img = Image.open(io.BytesIO(response.content))
|
|
||||||
img_png = img.convert("RGBA")
|
|
||||||
buffered = io.BytesIO()
|
|
||||||
img_png.save(buffered, format="PNG")
|
|
||||||
encoded_image = base64.b64encode(buffered.getvalue()).decode(
|
|
||||||
"ascii"
|
|
||||||
)
|
|
||||||
return encoded_image
|
|
||||||
except:
|
|
||||||
return None
|
|
||||||
|
|
||||||
urls = re.findall(r'https://[^\s"]+\.webp', text)
|
|
||||||
if len(urls) > 0:
|
|
||||||
for url in urls:
|
|
||||||
if filtered:
|
|
||||||
break
|
|
||||||
|
|
||||||
logger.info("[*] downloading... %s" % (url))
|
|
||||||
encoded_image = webp_to_png_base64(url)
|
|
||||||
logger.info("[*] downloaded.")
|
|
||||||
if encoded_image:
|
|
||||||
logger.info("[*] solving...")
|
|
||||||
try:
|
|
||||||
solved = self.truecaptcha_solve(encoded_image)
|
|
||||||
if solved:
|
|
||||||
logger.info("[*] solved: %s" % (solved))
|
|
||||||
filtered = filtered or (
|
|
||||||
solved.lower() in ["ctkpaarr", "spam"]
|
|
||||||
)
|
|
||||||
else:
|
|
||||||
logger.info("[*] not solved")
|
|
||||||
except Exception as e:
|
|
||||||
logger.error(
|
|
||||||
"[*] Not CAPTCHA strategy not working!", exc_info=e
|
|
||||||
)
|
|
||||||
|
|
||||||
if filtered:
|
|
||||||
logger.warning("[*] BLOCKED MESSAGE: %s" % (text))
|
|
||||||
|
|
||||||
return filtered
|
|
||||||
|
|
||||||
# Strategy: K-Anonymity test - use api.pwnedpasswords.com
|
|
||||||
def pwnedpasswords_test(self, s):
|
|
||||||
# convert to lowercase
|
|
||||||
s = s.lower()
|
|
||||||
|
|
||||||
# SHA1 of the password
|
|
||||||
p_sha1 = hashlib.sha1(s.encode()).hexdigest()
|
|
||||||
|
|
||||||
# First 5 char of SHA1 for k-anonymity API use
|
|
||||||
f5_sha1 = p_sha1[:5]
|
|
||||||
|
|
||||||
# Last 5 char of SHA1 to match API output
|
|
||||||
l5_sha1 = p_sha1[-5:]
|
|
||||||
|
|
||||||
# Making GET request using Requests library
|
|
||||||
response = requests.get(f"https://api.pwnedpasswords.com/range/{f5_sha1}")
|
|
||||||
|
|
||||||
# Checking if request was successful
|
|
||||||
if response.status_code == 200:
|
|
||||||
# Parsing response text
|
|
||||||
hashes = response.text.split("\r\n")
|
|
||||||
|
|
||||||
# Using list comprehension to find matching hashes
|
|
||||||
matching_hashes = [
|
|
||||||
line.split(":")[0] for line in hashes if line.endswith(l5_sha1)
|
|
||||||
]
|
|
||||||
|
|
||||||
# If there are matching hashes, return True, else return False
|
|
||||||
return bool(matching_hashes)
|
|
||||||
else:
|
|
||||||
raise Exception(
|
|
||||||
"api.pwnedpasswords.com response status: %s"
|
|
||||||
% (str(response.status_code))
|
|
||||||
)
|
|
||||||
|
|
||||||
return False
|
|
||||||
|
|
||||||
# Strategy: Not-CAPTCHA - use truecaptcha.org
|
|
||||||
def truecaptcha_solve(self, encoded_image):
|
|
||||||
url = "https://api.apitruecaptcha.org/one/gettext"
|
|
||||||
data = {
|
|
||||||
"userid": truecaptcha_userid,
|
|
||||||
"apikey": truecaptcha_apikey,
|
|
||||||
"data": encoded_image,
|
|
||||||
"mode": "human",
|
|
||||||
"case": "lower"
|
|
||||||
}
|
|
||||||
response = requests.post(url=url, json=data)
|
|
||||||
|
|
||||||
if response.status_code == 200:
|
|
||||||
data = response.json()
|
|
||||||
|
|
||||||
if "error_message" in data:
|
|
||||||
print("[*] Error: %s" % (data["error_message"]))
|
|
||||||
return None
|
|
||||||
if "result" in data:
|
|
||||||
return data["result"]
|
|
||||||
else:
|
|
||||||
raise Exception(
|
|
||||||
"api.apitruecaptcha.org response status: %s"
|
|
||||||
% (str(response.status_code))
|
|
||||||
)
|
|
||||||
|
|
||||||
return None
|
|
||||||
|
|
||||||
# Strategy: VowelRatio10
|
|
||||||
def calculate_vowel_ratio(self, s):
|
|
||||||
# Calculate the length of the string.
|
|
||||||
length = len(s)
|
|
||||||
if length == 0:
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
# Count the number of vowels ('a', 'e', 'i', 'o', 'u', 'w', 'y') in the string.
|
|
||||||
vowel_count = sum(1 for char in s if char.lower() in "aeiouwy")
|
|
||||||
|
|
||||||
# Define vowel-ending patterns
|
|
||||||
vowel_ending_patterns = ["ang", "eng", "ing", "ong", "ung", "ank", "ink", "dge"]
|
|
||||||
|
|
||||||
# Count the occurrences of vowel-ending patterns in the string.
|
|
||||||
vowel_count += sum(s.count(pattern) for pattern in vowel_ending_patterns)
|
|
||||||
|
|
||||||
# Calculate the ratio of vowels to the total length of the string.
|
|
||||||
vowel_ratio = vowel_count / length
|
|
||||||
|
|
||||||
return vowel_ratio
|
|
||||||
|
|
||||||
# Strategy: Palindrome4
|
|
||||||
def has_palindrome(self, input_string):
|
|
||||||
def is_palindrome(s):
|
|
||||||
return s == s[::-1]
|
|
||||||
|
|
||||||
input_string = input_string.lower()
|
|
||||||
n = len(input_string)
|
|
||||||
for i in range(n):
|
|
||||||
for j in range(i + 4, n + 1): # Find substrings of at least 5 characters
|
|
||||||
substring = input_string[i:j]
|
|
||||||
if is_palindrome(substring):
|
|
||||||
return True
|
|
||||||
return False
|
|
||||||
|
|
||||||
# Strategy: KnownWords4
|
|
||||||
def has_known_word(self, input_string):
|
|
||||||
def is_known_word(s):
|
|
||||||
return s in self.known_words
|
|
||||||
|
|
||||||
input_string = input_string.lower()
|
|
||||||
n = len(input_string)
|
|
||||||
for i in range(n):
|
|
||||||
for j in range(i + 4, n + 1): # Find substrings of at least 5 characters
|
|
||||||
substring = input_string[i:j]
|
|
||||||
if is_known_word(substring):
|
|
||||||
return True
|
|
||||||
return False
|
|
||||||
|
|
||||||
# Strategy: SearchEngine3
|
|
||||||
def search_engine_test(self, s):
|
|
||||||
url = "%s/api.php?q=%s" % (librey_apiurl, s)
|
|
||||||
response = requests.get(url, verify=False)
|
|
||||||
if response.status_code != 200:
|
|
||||||
return False
|
|
||||||
|
|
||||||
data = response.json()
|
|
||||||
|
|
||||||
if "results_source" in data:
|
|
||||||
del data["results_source"]
|
|
||||||
|
|
||||||
num_results = len(data)
|
|
||||||
|
|
||||||
return num_results > 2
|
|
||||||
|
|
||||||
# Strategy: RepeatedNumbers3
|
|
||||||
def repeated_numbers_test(self, s):
|
|
||||||
return bool(re.search(r"\d{3,}", s))
|
|
|
@ -1,35 +0,0 @@
|
||||||
#!/usr/bin/python3
|
|
||||||
#
|
|
||||||
# portscanner.py
|
|
||||||
# NMAP port scanning wrapper for Caterpillar Proxy
|
|
||||||
#
|
|
||||||
# Caterpillar Proxy - The simple web debugging proxy (formerly, php-httpproxy)
|
|
||||||
# Namyheon Go (Catswords Research) <gnh1201@gmail.com>
|
|
||||||
# https://github.com/gnh1201/caterpillar
|
|
||||||
# Created at: 2022-01-26 (from github.com/gnh1201/welsonjs)
|
|
||||||
# Updated at: 2024-07-11
|
|
||||||
#
|
|
||||||
import sys
|
|
||||||
import nmap
|
|
||||||
|
|
||||||
from base import Extension
|
|
||||||
|
|
||||||
|
|
||||||
class PortScanner(Extension):
|
|
||||||
def __init__(self):
|
|
||||||
self.type = "rpcmethod"
|
|
||||||
self.method = "scan_ports_by_hosts"
|
|
||||||
self.exported_methods = []
|
|
||||||
|
|
||||||
def dispatch(self, type, id, params, conn):
|
|
||||||
hosts = params["hosts"]
|
|
||||||
binpath = params["binpath"]
|
|
||||||
|
|
||||||
nm = nmap.PortScanner(nmap_search_path=(binpath,))
|
|
||||||
result = nm.scan(hosts=hosts, arguments="-T5 -sV -p0-65535 --max-retries 0")
|
|
||||||
|
|
||||||
return result
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
main(sys.argv)
|
|
|
@ -1,62 +0,0 @@
|
||||||
#!/usr/bin/python3
|
|
||||||
#
|
|
||||||
# serial.py
|
|
||||||
# Serial integration plugin for Caterpillar Proxy
|
|
||||||
#
|
|
||||||
# Caterpillar Proxy - The simple web debugging proxy (formerly, php-httpproxy)
|
|
||||||
# Teakwoo Kim <catry.me@gmail.com>
|
|
||||||
# https://github.com/gnh1201/caterpillar
|
|
||||||
# Created at: 2024-08-11
|
|
||||||
# Updated at: 2024-08-11
|
|
||||||
#
|
|
||||||
|
|
||||||
import serial
|
|
||||||
from decouple import config
|
|
||||||
from base import Extension, Logger
|
|
||||||
|
|
||||||
logger = Logger(name="serial")
|
|
||||||
|
|
||||||
try:
|
|
||||||
client_encoding = config("CLIENT_ENCODING")
|
|
||||||
except Exception as e:
|
|
||||||
logger.error("[*] Invalid configuration", exc_info=e)
|
|
||||||
|
|
||||||
import logging
|
|
||||||
|
|
||||||
logger = logging.getLogger(__name__)
|
|
||||||
|
|
||||||
|
|
||||||
class Serial(Extension):
|
|
||||||
def __init__(self):
|
|
||||||
self.type = "connector"
|
|
||||||
self.connection_type = "serial"
|
|
||||||
|
|
||||||
def dispatch(self, type, id, params, conn):
|
|
||||||
logger.info("[*] Greeting! dispatch")
|
|
||||||
conn.send(b"Greeting! dispatch")
|
|
||||||
|
|
||||||
def connect(self, conn, data, webserver, port, scheme, method, url):
|
|
||||||
connected = False
|
|
||||||
ser = None
|
|
||||||
try:
|
|
||||||
port_path = url.decode(client_encoding).replace("/", "")
|
|
||||||
if not ser:
|
|
||||||
ser = serial.Serial(port_path, baudrate=9600, timeout=2)
|
|
||||||
connected = True
|
|
||||||
logger.debug(f"Connected to {port_path} at 9600 baudrate")
|
|
||||||
|
|
||||||
ser.write(data)
|
|
||||||
logger.debug(f"Data sent to {port_path}: {data}")
|
|
||||||
|
|
||||||
ser_data = ser.read_all()
|
|
||||||
logger.debug(f"Data received: {ser_data}")
|
|
||||||
|
|
||||||
if ser_data:
|
|
||||||
conn.send(ser_data.decode(client_encoding))
|
|
||||||
except serial.SerialException as e:
|
|
||||||
logger.error(f"Failed to connect to {port}", exc_info=e)
|
|
||||||
finally:
|
|
||||||
if ser and ser.is_open:
|
|
||||||
ser.close()
|
|
||||||
logger.debug(f"Serial port {port_path} closed")
|
|
||||||
return connected
|
|
|
@ -1,107 +0,0 @@
|
||||||
#!/usr/bin/python3
|
|
||||||
#
|
|
||||||
# wayback.py
|
|
||||||
# Cached previous page (e.g. Wayback Machine) integration plugin for Caterpillar Proxy
|
|
||||||
#
|
|
||||||
# Caterpillar Proxy - The simple and parasitic web proxy with SPAM filter
|
|
||||||
# Namyheon Go (Catswords Research) <gnh1201@gmail.com>
|
|
||||||
# https://github.com/gnh1201/caterpillar
|
|
||||||
# Created at: 2024-03-13
|
|
||||||
# Updated at: 2024-07-06
|
|
||||||
#
|
|
||||||
|
|
||||||
import requests
|
|
||||||
from decouple import config
|
|
||||||
|
|
||||||
from base import Extension, Logger
|
|
||||||
|
|
||||||
logger = Logger(name="wayback")
|
|
||||||
|
|
||||||
try:
|
|
||||||
client_encoding = config("CLIENT_ENCODING")
|
|
||||||
except Exception as e:
|
|
||||||
logger.error("[*] Invalid configuration", exc_info=e)
|
|
||||||
|
|
||||||
|
|
||||||
def get_cached_page_from_google(url):
|
|
||||||
status_code, text = (0, "")
|
|
||||||
|
|
||||||
# Google Cache URL
|
|
||||||
google_cache_url = "https://webcache.googleusercontent.com/search?q=cache:" + url
|
|
||||||
|
|
||||||
# Send a GET request to Google Cache URL
|
|
||||||
response = requests.get(google_cache_url)
|
|
||||||
|
|
||||||
# Check if the request was successful (status code 200)
|
|
||||||
if response.status_code == 200:
|
|
||||||
text = response.text # Extract content from response
|
|
||||||
else:
|
|
||||||
status_code = response.status_code
|
|
||||||
|
|
||||||
return status_code, text
|
|
||||||
|
|
||||||
|
|
||||||
# API documentation: https://archive.org/help/wayback_api.php
|
|
||||||
def get_cached_page_from_wayback(url):
|
|
||||||
status_code, text = (0, "")
|
|
||||||
|
|
||||||
# Wayback Machine API URL
|
|
||||||
wayback_api_url = "http://archive.org/wayback/available?url=" + url
|
|
||||||
|
|
||||||
# Send a GET request to Wayback Machine API
|
|
||||||
response = requests.get(wayback_api_url)
|
|
||||||
|
|
||||||
# Check if the request was successful (status code 200)
|
|
||||||
if response.status_code == 200:
|
|
||||||
try:
|
|
||||||
# Parse JSON response
|
|
||||||
data = response.json()
|
|
||||||
archived_snapshots = data.get("archived_snapshots", {})
|
|
||||||
closest_snapshot = archived_snapshots.get("closest", {})
|
|
||||||
|
|
||||||
# Check if the URL is available in the archive
|
|
||||||
if closest_snapshot:
|
|
||||||
archived_url = closest_snapshot.get("url", "")
|
|
||||||
|
|
||||||
# If URL is available, fetch the content of the archived page
|
|
||||||
if archived_url:
|
|
||||||
archived_page_response = requests.get(archived_url)
|
|
||||||
status_code = archived_page_response.status_code
|
|
||||||
if status_code == 200:
|
|
||||||
text = archived_page_response.text
|
|
||||||
else:
|
|
||||||
status_code = 404
|
|
||||||
else:
|
|
||||||
status_code = 404
|
|
||||||
except:
|
|
||||||
status_code = 502
|
|
||||||
else:
|
|
||||||
status_code = response.status_code
|
|
||||||
|
|
||||||
return status_code, text
|
|
||||||
|
|
||||||
|
|
||||||
class Wayback(Extension):
|
|
||||||
def __init__(self):
|
|
||||||
self.type = "connector" # this is a connctor
|
|
||||||
self.connection_type = "wayback"
|
|
||||||
|
|
||||||
def connect(self, conn, data, webserver, port, scheme, method, url):
|
|
||||||
logger.info("[*] Connecting... Connecting...")
|
|
||||||
connected = False
|
|
||||||
|
|
||||||
target_url = url.decode(client_encoding)
|
|
||||||
|
|
||||||
if not connected:
|
|
||||||
status_code, text = get_cached_page_from_google(target_url)
|
|
||||||
if status_code == 200:
|
|
||||||
conn.send(text.encode(client_encoding))
|
|
||||||
connected = True
|
|
||||||
|
|
||||||
if not connected:
|
|
||||||
status_code, text = get_cached_page_from_wayback(target_url)
|
|
||||||
if status_code == 200:
|
|
||||||
conn.send(text.encode(client_encoding))
|
|
||||||
connected = True
|
|
||||||
|
|
||||||
return connected
|
|
Loading…
Reference in New Issue
Block a user