#!/usr/bin/python3 # # bio.py # Biopython plugin for Caterpillar Proxy # # Euiseo Cha (Wonkwang University) # https://github.com/gnh1201/caterpillar # Created at: 2024-07-02 # Updated at: 2024-07-02 # from socket import socket from Bio.Seq import Seq from Bio.SeqUtils import gc_fraction from base import Extension def _analyze_sequence(sequence: str) -> dict[str, str]: """ Analyze a given DNA sequence to provide various nucleotide transformations and translations. :param sequence: DNA sequence (string) to be analyzed. :return: Dictionary containing the following analyses of the sequence: - complement: DNA complement of the sequence. - complement_rna: RNA complement of the sequence. - reverse_complement: Reverse complement of the DNA sequence. - reverse_complement_rna: Reverse complement of the RNA sequence. - transcription: Transcription of the DNA sequence to RNA. - translation: Translation of the RNA sequence to an amino acid sequence. - back_transcribe: Back-transcription of the RNA sequence to DNA. """ sequence_object = Seq(sequence) return dict( complement=str(sequence_object.complement()), complement_rna=str(sequence_object.complement_rna()), reverse_complement=str(sequence_object.reverse_complement()), reverse_complement_rna=str(sequence_object.reverse_complement_rna()), transcription=str(sequence_object.transcribe()), translation=str(sequence_object.translate()), back_transcribe=str(sequence_object.back_transcribe()), ) def _gc_content_calculation(sequence: str) -> dict[str, str]: """ Calculate the GC content of a given DNA sequence and return it as a float. :param sequence: DNA sequence (string) for which to calculate the GC content. :return: Dictionary containing the GC content as a float. """ gc_content = gc_fraction(sequence) return dict( gc_content=gc_content, ) class PyBio(Extension): def __init__(self): self.type = "rpcmethod" self.method = "analyze_sequence_init" self.exported_methods = ["analyze_sequence", "gc_content_calculation"] def dispatch(self, type, id, params, conn): conn.send(b"Greeting! dispatch") def analyze_sequence(self, type, id, params, conn: socket): """ Analyze a DNA sequence provided in the params dictionary. :param type: Not used in this function. :param id: Not used in this function. :param params: Dictionary containing the DNA sequence with the key "sequence". Example: {"sequence": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT"} :param conn: Not used in this function. :return: Dictionary containing various analyses of the DNA sequence: - back_transcribe: Back-transcription of the RNA sequence to DNA. - complement: DNA complement of the sequence. - complement_rna: RNA complement of the sequence. - reverse_complement: Reverse complement of the DNA sequence. - reverse_complement_rna: Reverse complement of the RNA sequence. - transcription: Transcription of the DNA sequence to RNA. - translation: Translation of the RNA sequence to an amino acid sequence. Example: {"back_transcribe": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT", "complement": "TACGCATGCATCGATCGATCGCATCGATCGACTGA", "complement_rna": "UACGCAUGCAUCGAUCGAUCGCAUCGAUCGACUGA", "reverse_complement": "AGTCAGCTAGCTACGCTAGCTAGCTACGTACGCAT", "reverse_complement_rna": "AGUCAGCUAGCUACGCUAGCUAGCUACGUACGCAU", "transcription": "AUGCGUACGUAGCUAGCUAGCGUAGCUAGCUGACU", "translation": "MRT*LASVAS*"} """ result = _analyze_sequence(params["sequence"]) return result def gc_content_calculation(self, type, id, params, conn: socket): """ Calculate the GC content for a given DNA sequence provided in the params dictionary. :param type: Not used in this function. :param id: Not used in this function. :param params: Dictionary containing the DNA sequence with the key "sequence". Example: {"sequence": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT"} :param conn: Not used in this function. :return: Dictionary containing the GC content as a float. Example: {"gc_content": 0.5142857142857142} """ result = _gc_content_calculation(params["sequence"]) return result