Merge pull request #23 from zeroday0619/biopython

Create bio.py

plugins/bio.py

@@ -0,0 +1,108 @@
+#!/usr/bin/python3
+#
+# bio.py
+# Biopython plugin for Caterpillar Proxy
+#
+# Euiseo Cha (Wonkwang University) <zeroday0619_dev@outlook.com>
+# https://github.com/gnh1201/caterpillar
+# Created at: 2024-07-02
+# Updated at: 2024-07-02
+#
+
+import json
+from Bio.Seq import Seq
+from Bio.SeqUtils import gc_fraction
+
+from server import Extension
+
+
+def _analyze_sequence(sequence) -> dict[str, str]:
+    """
+    Analyze a given DNA sequence to provide various nucleotide transformations and translations.
+
+    :param sequence: DNA sequence (string) to be analyzed.
+    :return: Dictionary containing the following analyses of the sequence:
+             - complement: DNA complement of the sequence.
+             - complement_rna: RNA complement of the sequence.
+             - reverse_complement: Reverse complement of the DNA sequence.
+             - reverse_complement_rna: Reverse complement of the RNA sequence.
+             - transcription: Transcription of the DNA sequence to RNA.
+             - translation: Translation of the RNA sequence to an amino acid sequence.
+             - back_transcribe: Back-transcription of the RNA sequence to DNA.
+    """
+    sequence_object = Seq(sequence)
+    return dict(
+        complement=str(sequence_object.complement()),
+        complement_rna=str(sequence_object.complement_rna()),
+        reverse_complement=str(sequence_object.reverse_complement()),
+        reverse_complement_rna=str(sequence_object.reverse_complement_rna()),
+        transcription=str(sequence_object.transcribe()),
+        translation=str(sequence_object.translate()),
+        back_transcribe=str(sequence_object.back_transcribe()),
+    )
+
+
+def _gc_content_calculation(sequence) -> dict[str, str]:
+    """
+    Calculate the GC content of a given DNA sequence and return it as a float.
+
+    :param sequence: DNA sequence (string) for which to calculate the GC content.
+    :return: Dictionary containing the GC content as a float.
+    """
+    gc_content = gc_fraction(sequence)
+    return dict(
+        gc_content=gc_content,
+    )
+
+
+class PyBio(Extension):
+    def __init__(self):
+        self.type = "rpcmethod"
+        self.method = "analyze_sequence_init"
+        self.exported_methods = ["analyze_sequence", "gc_content_calculation"]
+
+    def dispatch(self, type, id, params, conn):
+        conn.send(b'Greeting! dispatch')
+
+    def analyze_sequence(self, type, id, params, conn):
+        """
+        Analyze a DNA sequence provided in the params dictionary.
+
+        :param type: Not used in this function.
+        :param id: Not used in this function.
+        :param params: Dictionary containing the DNA sequence with the key "sequence".
+                       Example: {"sequence": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT"}
+        :param conn: Not used in this function.
+        :return: Dictionary containing various analyses of the DNA sequence:
+                 - back_transcribe: Back-transcription of the RNA sequence to DNA.
+                 - complement: DNA complement of the sequence.
+                 - complement_rna: RNA complement of the sequence.
+                 - reverse_complement: Reverse complement of the DNA sequence.
+                 - reverse_complement_rna: Reverse complement of the RNA sequence.
+                 - transcription: Transcription of the DNA sequence to RNA.
+                 - translation: Translation of the RNA sequence to an amino acid sequence.
+                 Example: {"back_transcribe": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT",
+                           "complement": "TACGCATGCATCGATCGATCGCATCGATCGACTGA",
+                           "complement_rna": "UACGCAUGCAUCGAUCGAUCGCAUCGAUCGACUGA",
+                           "reverse_complement": "AGTCAGCTAGCTACGCTAGCTAGCTACGTACGCAT",
+                           "reverse_complement_rna": "AGUCAGCUAGCUACGCUAGCUAGCUACGUACGCAU",
+                           "transcription": "AUGCGUACGUAGCUAGCUAGCGUAGCUAGCUGACU",
+                           "translation": "MRT*LASVAS*"}
+        """
+        result = _analyze_sequence(params['sequence'])
+        return result
+
+    def gc_content_calculation(self, type, id, params, conn):
+        """
+        Calculate the GC content for a given DNA sequence provided in the params dictionary.
+
+        :param type: Not used in this function.
+        :param id: Not used in this function.
+        :param params: Dictionary containing the DNA sequence with the key "sequence".
+                       Example: {"sequence": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT"}
+        :param conn: Not used in this function.
+        :return: Dictionary containing the GC content as a float.
+                 Example: {"gc_content": 0.5142857142857142}
+        """
+        result = _gc_content_calculation(params['sequence'])
+        return result