gnh1201/caterpillar
1
0
Fork 0
mirror of https://github.com/gnh1201/caterpillar.git synced 2025-02-06 06:55:00 +00:00
Code Issues Actions Packages Projects Releases Wiki Activity

feat: removed unnecessary code and added comments

Browse Source
This commit is contained in:
Euiseo Cha 2024-07-05 20:50:39 +09:00
parent 001852956c
commit 9133f75c38
No known key found for this signature in database
GPG Key ID: 220CC17AA79A0AEA
1 changed files with 54 additions and 1 deletions
Show Stats Download Patch File Download Diff File Expand all files Collapse all files

55
plugins/bio.py
View File

@ -17,6 +17,19 @@ from server import Extension
def _analyze_sequence(sequence) -> dict[str, str]:
"""
Analyze a given DNA sequence to provide various nucleotide transformations and translations.
:param sequence: DNA sequence (string) to be analyzed.
:return: Dictionary containing the following analyses of the sequence:
- complement: DNA complement of the sequence.
- complement_rna: RNA complement of the sequence.
- reverse_complement: Reverse complement of the DNA sequence.
- reverse_complement_rna: Reverse complement of the RNA sequence.
- transcription: Transcription of the DNA sequence to RNA.
- translation: Translation of the RNA sequence to an amino acid sequence.
- back_transcribe: Back-transcription of the RNA sequence to DNA.
"""
sequence_object = Seq(sequence)
return dict(
complement=str(sequence_object.complement()),
@ -30,6 +43,12 @@ def _analyze_sequence(sequence) -> dict[str, str]:
def _gc_content_calculation(sequence) -> dict[str, str]:
"""
Calculate the GC content of a given DNA sequence and return it as a float.
:param sequence: DNA sequence (string) for which to calculate the GC content.
:return: Dictionary containing the GC content as a float.
"""
gc_content = gc_fraction(sequence)
return dict(
gc_content=gc_content,
@ -43,13 +62,47 @@ class PyBio(Extension):
self.exported_methods = ["analyze_sequence", "gc_content_calculation"]
def dispatch(self, type, id, params, conn):
print("[*] Greeting! dispatch")
conn.send(b'Greeting! dispatch')
def analyze_sequence(self, type, id, params, conn):
"""
Analyze a DNA sequence provided in the params dictionary.
:param type: Not used in this function.
:param id: Not used in this function.
:param params: Dictionary containing the DNA sequence with the key "sequence".
Example: {"sequence": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT"}
:param conn: Not used in this function.
:return: Dictionary containing various analyses of the DNA sequence:
- back_transcribe: Back-transcription of the RNA sequence to DNA.
- complement: DNA complement of the sequence.
- complement_rna: RNA complement of the sequence.
- reverse_complement: Reverse complement of the DNA sequence.
- reverse_complement_rna: Reverse complement of the RNA sequence.
- transcription: Transcription of the DNA sequence to RNA.
- translation: Translation of the RNA sequence to an amino acid sequence.
Example: {"back_transcribe": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT",
"complement": "TACGCATGCATCGATCGATCGCATCGATCGACTGA",
"complement_rna": "UACGCAUGCAUCGAUCGAUCGCAUCGAUCGACUGA",
"reverse_complement": "AGTCAGCTAGCTACGCTAGCTAGCTACGTACGCAT",
"reverse_complement_rna": "AGUCAGCUAGCUACGCUAGCUAGCUACGUACGCAU",
"transcription": "AUGCGUACGUAGCUAGCUAGCGUAGCUAGCUGACU",
"translation": "MRT*LASVAS*"}
"""
result = _analyze_sequence(params['sequence'])
return result
def gc_content_calculation(self, type, id, params, conn):
"""
Calculate the GC content for a given DNA sequence provided in the params dictionary.
:param type: Not used in this function.
:param id: Not used in this function.
:param params: Dictionary containing the DNA sequence with the key "sequence".
Example: {"sequence": "ATGCGTACGTAGCTAGCTAGCGTAGCTAGCTGACT"}
:param conn: Not used in this function.
:return: Dictionary containing the GC content as a float.
Example: {"gc_content": 0.5142857142857142}
"""
result = _gc_content_calculation(params['sequence'])
return result